ID: 912919071_912919077

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 912919071 912919077
Species Human (GRCh38) Human (GRCh38)
Location 1:113847976-113847998 1:113847991-113848013
Sequence CCTTCCACCTTGGCCTTCCAAAG TTCCAAAGTGCTGGGATTACAGG
Strand - +
Off-target summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118} {0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!