ID: 912920973_912920987

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 912920973 912920987
Species Human (GRCh38) Human (GRCh38)
Location 1:113866828-113866850 1:113866869-113866891
Sequence CCCTCCACCCCCTGGGGTCAAGT TCCCAGGTAGCTGGGATTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 96, 3: 488, 4: 1358} {0: 2001, 1: 53931, 2: 148281, 3: 254269, 4: 530010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!