|
Left Crispr |
Right Crispr |
| Crispr ID |
912990731 |
912990738 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:114483671-114483693
|
1:114483706-114483728
|
| Sequence |
CCAAAGTGCTGGGATTACAGTGT |
CCGGCCCCAGTTGGTTTTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 183, 1: 1094, 2: 16388, 3: 329202, 4: 271997} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|