ID: 913112326_913112342

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 913112326 913112342
Species Human (GRCh38) Human (GRCh38)
Location 1:115667534-115667556 1:115667571-115667593
Sequence CCCCTCTTACAGTTGAGGTCCCC GGGACCTGCTCAAGGTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 85} {0: 1, 1: 7, 2: 50, 3: 259, 4: 793}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!