ID: 913215741_913215746

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913215741 913215746
Species Human (GRCh38) Human (GRCh38)
Location 1:116618853-116618875 1:116618870-116618892
Sequence CCATACATCTCCTGCAAAGAAGG AGAAGGCTAGAGGCAAGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 0, 3: 16, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!