ID: 913412014_913412021

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 913412014 913412021
Species Human (GRCh38) Human (GRCh38)
Location 1:118562575-118562597 1:118562601-118562623
Sequence CCTTTTCAGTAAATGGTTCTGGT TTGGATATGAATAAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 30, 3: 552, 4: 3326} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!