ID: 913520856_913520860

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 913520856 913520860
Species Human (GRCh38) Human (GRCh38)
Location 1:119644970-119644992 1:119645022-119645044
Sequence CCTTCATAATTGAATGGAAACAG AAATTGTTGATTATTTGCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 59, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!