ID: 913681572_913681579

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 913681572 913681579
Species Human (GRCh38) Human (GRCh38)
Location 1:121190913-121190935 1:121190954-121190976
Sequence CCACCTGCTTGCATGTGCCCTGA GCCCCAACCCTACCCCAGAGTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 27, 4: 226} {0: 4, 1: 0, 2: 2, 3: 20, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!