ID: 913700054_913700057

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 913700054 913700057
Species Human (GRCh38) Human (GRCh38)
Location 1:121365652-121365674 1:121365669-121365691
Sequence CCGTTAGCAGCAAACCAGGGACC GGGACCCTGAACTAATGGCAAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 0, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!