ID: 913971988_913972005

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 913971988 913972005
Species Human (GRCh38) Human (GRCh38)
Location 1:143423065-143423087 1:143423096-143423118
Sequence CCTTGGTTGTGCCACAGGCAGGG CCAGGGAGGGGGTAGTCCGGGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 1, 3: 26, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!