ID: 914133006_914133009

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 914133006 914133009
Species Human (GRCh38) Human (GRCh38)
Location 1:144875949-144875971 1:144875970-144875992
Sequence CCTGTATCAATCTAGGCCCAAAT ATAGTCAATTGTTTCAAAGTAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 12, 3: 5, 4: 70} {0: 12, 1: 8, 2: 1, 3: 20, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!