ID: 914490204_914490213

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 914490204 914490213
Species Human (GRCh38) Human (GRCh38)
Location 1:148146867-148146889 1:148146906-148146928
Sequence CCGAGAGGAACCTCTATGCCGAC AGGCCCTGCGCACCAGGTGAGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 6, 3: 9, 4: 55} {0: 11, 1: 0, 2: 1, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!