ID: 914542440_914542443

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914542440 914542443
Species Human (GRCh38) Human (GRCh38)
Location 1:148627907-148627929 1:148627920-148627942
Sequence CCTTAAAAAGACCCTATAAATAC CTATAAATACACTTGAAGTTTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 2, 3: 12, 4: 243} {0: 5, 1: 0, 2: 2, 3: 17, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!