ID: 914582744_914582755

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 914582744 914582755
Species Human (GRCh38) Human (GRCh38)
Location 1:149033767-149033789 1:149033805-149033827
Sequence CCTATGACACCTCTCCCCCAACC AGAGAGAATCTAATGGCTTGGGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 7, 3: 61, 4: 432} {0: 5, 1: 0, 2: 1, 3: 22, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!