ID: 914663047_914663056

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914663047 914663056
Species Human (GRCh38) Human (GRCh38)
Location 1:149809085-149809107 1:149809120-149809142
Sequence CCAATCTCAATGCCCTGACCCAG TCTACATGTGCAGTGTTCTCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 14, 4: 214} {0: 3, 1: 0, 2: 0, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!