ID: 914665967_914665971

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 914665967 914665971
Species Human (GRCh38) Human (GRCh38)
Location 1:149832785-149832807 1:149832808-149832830
Sequence CCATTCGGCGTCTAGCTCGGCGT GGCGGCGTTAAGCGGATCTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 13} {0: 2, 1: 0, 2: 4, 3: 4, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!