ID: 914675413_914675423

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 914675413 914675423
Species Human (GRCh38) Human (GRCh38)
Location 1:149904186-149904208 1:149904222-149904244
Sequence CCAGGCTGGCCTAGGGCTCCTCC CACAGAAACCAGATTAGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 1085} {0: 1, 1: 0, 2: 1, 3: 30, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!