ID: 914812266_914812272

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914812266 914812272
Species Human (GRCh38) Human (GRCh38)
Location 1:151037657-151037679 1:151037671-151037693
Sequence CCCTAGGTGAGGACGTGTGAGGG GTGTGAGGGTGGCTGGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 90} {0: 1, 1: 0, 2: 13, 3: 161, 4: 1158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!