ID: 914822112_914822117

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 914822112 914822117
Species Human (GRCh38) Human (GRCh38)
Location 1:151112629-151112651 1:151112676-151112698
Sequence CCGCACCTGGCCGACTATGCTGG GAACCCTGGCCAAATTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201} {0: 1, 1: 1, 2: 8, 3: 13, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!