ID: 914848727_914848731

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 914848727 914848731
Species Human (GRCh38) Human (GRCh38)
Location 1:151297979-151298001 1:151298003-151298025
Sequence CCTGGGTCACTGTTGGGAGATAC CTTAGAAGGCAGGGCCTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116} {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!