ID: 914909763_914909766

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 914909763 914909766
Species Human (GRCh38) Human (GRCh38)
Location 1:151775472-151775494 1:151775517-151775539
Sequence CCAGAGGCTTCCAGTCAGCACAA CCAAAGCTTCCTCTTCCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167} {0: 1, 1: 0, 2: 4, 3: 47, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!