ID: 914950343_914950349

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 914950343 914950349
Species Human (GRCh38) Human (GRCh38)
Location 1:152108521-152108543 1:152108569-152108591
Sequence CCTGGCGCAGCTGTTCCTCCTCG GCCGCTGTTGCCCGCGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 5, 3: 28, 4: 316} {0: 1, 1: 0, 2: 1, 3: 13, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!