ID: 914993093_914993111

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 914993093 914993111
Species Human (GRCh38) Human (GRCh38)
Location 1:152515456-152515478 1:152515493-152515515
Sequence CCCGCCCCGGCGCCCACCCCGGC CCTCCTGCTGCGGCTCCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 295, 4: 1580} {0: 1, 1: 0, 2: 4, 3: 36, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!