ID: 914993101_914993115

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914993101 914993115
Species Human (GRCh38) Human (GRCh38)
Location 1:152515473-152515495 1:152515504-152515526
Sequence CCCGGCGCCCGCCTCCTCCTCCT GGCTCCGGCAGGGGCTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 171, 4: 1133} {0: 1, 1: 0, 2: 7, 3: 91, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!