ID: 914993116_914993118

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 914993116 914993118
Species Human (GRCh38) Human (GRCh38)
Location 1:152515508-152515530 1:152515522-152515544
Sequence CCGGCAGGGGCTGCTGCGGCGAC TGCGGCGACTCAGGCTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 273} {0: 1, 1: 0, 2: 1, 3: 18, 4: 638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!