ID: 914998519_914998524

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 914998519 914998524
Species Human (GRCh38) Human (GRCh38)
Location 1:152565803-152565825 1:152565820-152565842
Sequence CCTCCAGCTCAGCCTGTGAAAGT GAAAGTCAGAAGAGGGTATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 1098} {0: 1, 1: 0, 2: 5, 3: 24, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!