ID: 914998829_914998835

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 914998829 914998835
Species Human (GRCh38) Human (GRCh38)
Location 1:152568621-152568643 1:152568655-152568677
Sequence CCCTCCCCCTTCTGTATACTGTT AATCATATCTTTACATTAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 264} {0: 1, 1: 0, 2: 1, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!