ID: 915085952_915085955

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 915085952 915085955
Species Human (GRCh38) Human (GRCh38)
Location 1:153389021-153389043 1:153389055-153389077
Sequence CCCAATTTCAGAGATGTATAGAC GAACCCTGGTTTAGTGATTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!