ID: 915141762_915141775

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 915141762 915141775
Species Human (GRCh38) Human (GRCh38)
Location 1:153772453-153772475 1:153772493-153772515
Sequence CCCTCGGCGTCCAGTGTAGACGG CTATGCCTGGAGCCAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28} {0: 1, 1: 1, 2: 4, 3: 31, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!