ID: 915163112_915163122

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 915163112 915163122
Species Human (GRCh38) Human (GRCh38)
Location 1:153933436-153933458 1:153933474-153933496
Sequence CCAAGCCCACTAATGCTAAGGCA ACTGGCTACCTCGGAGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128} {0: 1, 1: 0, 2: 2, 3: 103, 4: 1641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!