ID: 915185819_915185825

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 915185819 915185825
Species Human (GRCh38) Human (GRCh38)
Location 1:154104499-154104521 1:154104529-154104551
Sequence CCACATGGGGCAGAGAGAGAATC CTGGGGAGTACAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 21, 3: 63, 4: 333} {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!