ID: 915190111_915190113

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 915190111 915190113
Species Human (GRCh38) Human (GRCh38)
Location 1:154142805-154142827 1:154142844-154142866
Sequence CCTGAAGCGGGAGGGCAGAGGTT GCACCACTGCACTTGAGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 126, 4: 1686} {0: 44, 1: 1765, 2: 54219, 3: 144259, 4: 212580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!