ID: 915248661_915248670

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915248661 915248670
Species Human (GRCh38) Human (GRCh38)
Location 1:154573029-154573051 1:154573056-154573078
Sequence CCAGGTTTCCTCTAGGACAGCTG TCTGGCTGGGGGATGAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 200} {0: 1, 1: 0, 2: 6, 3: 47, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!