ID: 915275519_915275528

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 915275519 915275528
Species Human (GRCh38) Human (GRCh38)
Location 1:154785422-154785444 1:154785448-154785470
Sequence CCTTCACCTCCTTCCCAAGGGCC TGCACTGTCACCCCTTCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 545} {0: 1, 1: 0, 2: 0, 3: 11, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!