ID: 915313892_915313913

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 915313892 915313913
Species Human (GRCh38) Human (GRCh38)
Location 1:155017544-155017566 1:155017596-155017618
Sequence CCGGAGCCGCCGCCACCGCTGCC CGCAGCGAAGGGTGTGGGACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 48, 3: 366, 4: 2484} {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!