ID: 915375773_915375779

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 915375773 915375779
Species Human (GRCh38) Human (GRCh38)
Location 1:155393905-155393927 1:155393957-155393979
Sequence CCAGGTGCTGGGAAATCCAGGGA CGGAGATTATAATCTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 291} {0: 1, 1: 0, 2: 2, 3: 41, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!