ID: 915410616_915410626

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 915410616 915410626
Species Human (GRCh38) Human (GRCh38)
Location 1:155698958-155698980 1:155699002-155699024
Sequence CCTCATGTTGGGCACCAGAATGT TCCGTAGGGTACCTGAAGTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 135} {0: 1, 1: 2, 2: 10, 3: 19, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!