ID: 915460634_915460637

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 915460634 915460637
Species Human (GRCh38) Human (GRCh38)
Location 1:156068594-156068616 1:156068608-156068630
Sequence CCCTCTTCCTCAGGATTTCCCAG ATTTCCCAGCACTTCCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 364} {0: 1, 1: 0, 2: 1, 3: 22, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!