ID: 915469274_915469281

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 915469274 915469281
Species Human (GRCh38) Human (GRCh38)
Location 1:156115869-156115891 1:156115908-156115930
Sequence CCTTGTCCTGGGTTCTAAGGGTT CTCTGCCACTCTGCGTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 647} {0: 1, 1: 0, 2: 0, 3: 15, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!