ID: 915495778_915495781

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 915495778 915495781
Species Human (GRCh38) Human (GRCh38)
Location 1:156281999-156282021 1:156282027-156282049
Sequence CCAAATCCCAAGAACGCTCTGGA AAGTCGTTCGTGACCCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109} {0: 1, 1: 0, 2: 2, 3: 3, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!