ID: 915496953_915496956

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 915496953 915496956
Species Human (GRCh38) Human (GRCh38)
Location 1:156288626-156288648 1:156288639-156288661
Sequence CCACACCTGGCCTGCTCTTGTTA GCTCTTGTTACTTTTGATACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 24, 3: 221, 4: 1401} {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!