ID: 915504031_915504036

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 915504031 915504036
Species Human (GRCh38) Human (GRCh38)
Location 1:156340908-156340930 1:156340943-156340965
Sequence CCACCTCTGTCTCCTTGATTCAA CCTCAGCCACCCAAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 43, 3: 547, 4: 1806} {0: 947, 1: 96300, 2: 207776, 3: 248482, 4: 261937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!