ID: 915544050_915544062

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 915544050 915544062
Species Human (GRCh38) Human (GRCh38)
Location 1:156585965-156585987 1:156586008-156586030
Sequence CCATCTTCCATTTGTAGGTCCAG CCTAGCATCTTGGTACCCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183} {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!