ID: 915553479_915553488

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 915553479 915553488
Species Human (GRCh38) Human (GRCh38)
Location 1:156648180-156648202 1:156648205-156648227
Sequence CCTCTGCAGGACCTTACTATCCC CTGAGTTTAAGGGGGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87} {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!