ID: 915558632_915558647

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915558632 915558647
Species Human (GRCh38) Human (GRCh38)
Location 1:156674099-156674121 1:156674126-156674148
Sequence CCTCGGGGCCCACCAGACCCTTC TGGTGGCTTCACTGGGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263} {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!