ID: 915595987_915595999

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 915595987 915595999
Species Human (GRCh38) Human (GRCh38)
Location 1:156896770-156896792 1:156896816-156896838
Sequence CCCTCCACCTCCAGGTGACTCAG TCCCATAGGAACTTGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 293} {0: 1, 1: 0, 2: 4, 3: 26, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!