ID: 915597301_915597308

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 915597301 915597308
Species Human (GRCh38) Human (GRCh38)
Location 1:156902891-156902913 1:156902909-156902931
Sequence CCATTTCCGAATGGCTGACAGGG CAGGGCAGTCTGAGGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72} {0: 1, 1: 0, 2: 1, 3: 57, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!