ID: 915598088_915598097

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 915598088 915598097
Species Human (GRCh38) Human (GRCh38)
Location 1:156906618-156906640 1:156906637-156906659
Sequence CCGCCTCCTTATCCCACAGAGTG AGTGTGCCCCAGGAATGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 304} {0: 1, 1: 1, 2: 0, 3: 22, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!