ID: 915604122_915604128

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 915604122 915604128
Species Human (GRCh38) Human (GRCh38)
Location 1:156940113-156940135 1:156940147-156940169
Sequence CCTTCGGGAAGGTGGAGGGTGCA GTTCACACTGGGTGTGCGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 370} {0: 1, 1: 0, 2: 1, 3: 2, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!