ID: 915665116_915665122

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 915665116 915665122
Species Human (GRCh38) Human (GRCh38)
Location 1:157437469-157437491 1:157437495-157437517
Sequence CCTTTTTTCCCCAACCCTGGCTG CACCAACCATCACAGCAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!